Journal: Cell reports

Article Title: ΔNp63 drives dysplastic alveolar remodeling and restricts epithelial plasticity upon severe lung injury

doi: 10.1016/j.celrep.2022.111805

Figure Lengend Snippet:

Article Snippet: PolyA-selected RNA was used to generate libraries using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions.

Techniques: Virus, Recombinant, Lysis, Magnetic Beads, Migration, Single-cell Transcriptomics, Software

Journal: BMC Biology

Article Title: Mapping chromatin remodelling in glioblastoma identifies epigenetic regulation of key molecular pathways and novel druggable targets

doi: 10.1186/s12915-025-02127-9

Figure Lengend Snippet: Integrative analysis of single histone modifications and gene expression reveals dynamic and synergistic epigenetic regulation of pathways involved in glioblastoma pathogenesis. a Pearson correlation heatmaps of integrative analysis of ChIP Seq data for each HM and RNAseq dataset for genes only found in GIC (left) or iNSC (right) for at least one HM. RNAseq data are represented as log fold change of Differentially Expressed (DE) genes between GIC and iNSC: logFC DE > 1 and < − 1 when genes are up (red section) and downregulated (blue section) in GIC as compared to iNSC respectively (left). LogFC DE > 1 and < − 1 when genes are down and upregulated in iNSC as compared to GIC respectively (right). b Percentages of upregulated (red) and downregulated (blue) genes in iNSC as compared to GIC (top) and in GIC as compared to iNSC (bottom) for each HM based on transcriptomic dataset from the SYNGN cohort . Number of genes is also specified for each condition. c mRNA expression of GSC in iNSC, GIC and bulk tumour from the RNAseq dataset of the SYNGN cohort (left) and in bulk tumour and non-tumour samples from TCGA dataset . Results are expressed in log 2 (tpm) transcript per million (tpm). One-way ANOVA test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. d Representative immunofluorescent images for GSC (green) in iNSC and GIC from patient 52. Nuclei are counterstained with DAPI. Scale bar: 50 µm. Quantification is shown as Mean Fluorescence Intensity (MFI) standardised by the number of nuclei. One-way ANOVA test. * p value < 0.05, ** p value < 0.01, *** p value < 0.001, **** p value < 0.0001. e GSC gene expression in non-tumour and bulk primary glioblastoma tumour (left panel). t-test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. f Survival curve of glioblastoma patients with high and low expression of GSC gene (right panel). Source: TCGA Stat test: log-rank, * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. g Spatial expression of GSC in glioblastoma bulk samples, analysed on Ivy –GAP . The left panel shows an example of histological anatomic structure identified in a sub-block and the right panel represents the expression of GSC in RNAseq data from anatomic structures shown as log2 normalised gene expression. Leading Edge defined as the border of the tumour, where ratio of tumour to normal cells is 1–3 / 100. Infiltrating tumour defined as the intermediate zone between leading edge and cellular tumour, where ratio of tumour to normal cells is 10–20 /100. Cellular tumour defined as tumour core, where tumour to normal cells is 100–500 / 1. One-way ANOVA test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. h Single-cell RNAseq data showing GSC expression (left panel) in scRNAseq of glioblastoma samples in clusters defined in (right panel). Data are plotted as tSNE, with logTPM expression ranging from light orange to dark

Article Snippet: At regional level (Glioblastoma Atlas Project—IvyGap) [ ], GSC expression is highest in the cellular tumour (tumour core) and show intermediate expression in the infiltrating tumour (ratio of tumour-to-normal cells 10–20/100) as compared to leading edge (ratio of tumour-to-normal cells 1–3/100 (Fig. g), with GSC being exclusively expressed in malignant cells at single-cell transcriptomic level (Single Cell Portal, The Broad Institute) [ ] (Fig. h).

Techniques: Gene Expression, ChIP-sequencing, Expressing, Fluorescence, Blocking Assay

Journal: BMC Biology

Article Title: Mapping chromatin remodelling in glioblastoma identifies epigenetic regulation of key molecular pathways and novel druggable targets

doi: 10.1186/s12915-025-02127-9

Figure Lengend Snippet: Comparative analysis of the functional impact of chromatin states dynamics in GIC and iNSC using automatic fragmentation analysis. a Chromatin states defined by enrichment of HM using ChromHMM . Probabilities of each HM in chromatin states are depicted as a heatmap. b Pie charts show percentages of peaks in each chromatin state in GIC (left) and iNSC (right). c Sankey diagram shows the switch of peaks from one chromatin state in iNSC to another in GIC. The thickness of the links is proportional to the number of peaks included. Flows with the highest number of peaks between two opposite state functions are highlighted in bold red (activating transition in GIC) and blue (repressing transition in GIC). d Percentages of upregulated (red) and downregulated (blue) genes in the chromatin states of interest based on transcriptomic dataset from the SYNGN Cohort . Number of genes is also specified for each condition. e Visualisation of the enriched pathways identified in GIC from genes activated in GIC as compared to iNSC and from genes inactivated in GIC as compared to iNSC. Pathways are annotated based on pathways enrichment analysis performed with Reactome and represented as circle, colours represent each histone (see legend), size of the circle is proportional to the number of genes involved in the pathway (FDR < 0.05)

Article Snippet: At regional level (Glioblastoma Atlas Project—IvyGap) [ ], GSC expression is highest in the cellular tumour (tumour core) and show intermediate expression in the infiltrating tumour (ratio of tumour-to-normal cells 10–20/100) as compared to leading edge (ratio of tumour-to-normal cells 1–3/100 (Fig. g), with GSC being exclusively expressed in malignant cells at single-cell transcriptomic level (Single Cell Portal, The Broad Institute) [ ] (Fig. h).

Techniques: Functional Assay

Journal: Molecular cancer therapeutics

Article Title: DHA-SBT-1214 Taxoid Nanoemulsion and Anti-PD-L1 Antibody Combination Therapy Enhances Anti-Tumor Efficacy in a Syngeneic Pancreatic Adenocarcinoma Model

doi: 10.1158/1535-7163.MCT-18-1046

Figure Lengend Snippet: In vivo efficacy of the PD-L1 antibody in combination to different therapeutic drugs including gemcitabine solution, Abraxane™, paclitaxel in solution, DHA-SBT-1214 in solution and NE-DHA-SBT-1214 against Panc02 induced syngeneic mice tumors. (A)– Graph summarizing all treatment modalities. The values are means ± SD (n=3). Significant differences are indicated as follows: *p < 0.05, and **p< 0.01. (B)– Tumor images taken at the time of harvest from different treatment modalities. (3b-A)– Tumors from mice treated with vehicle; (3b-B)– Three tumors each from PD-L1 (200μg) treated mice; (3b-C, D)–Tumors from Abraxane™ plus IgG or PD-L1 (200μg) treated mice respectively; (3b-E)– Tumors from NE-DHA-SBT-1214 (10mg/kg) plus IgG (200μg) treated mice; (3b-F, G)– Tumors from gemcitabine plus IgG or PD-L1 (200μg) treated mice respectively; (3b-H)– Tumors from NE-DHA-SBT-1214 (10mg/kg) plus PD-L1 (200μg) treated mice; (3b-I, J)– Tumors from NE-DHA-SBT-1214 (25mg/kg) plus IgG or PD-L1 (200μg) treated mice respectively. (C)– Graph for all the tumors from (3B) to show their progression over time.

Article Snippet: In Vivo Single and Combination Therapies Mouse antibody against PD-L1 (10F.9G2) and relevant isotype IgG control was purchased from Bio X Cell.

Techniques: In Vivo

Journal: Molecular cancer therapeutics

Article Title: DHA-SBT-1214 Taxoid Nanoemulsion and Anti-PD-L1 Antibody Combination Therapy Enhances Anti-Tumor Efficacy in a Syngeneic Pancreatic Adenocarcinoma Model

doi: 10.1158/1535-7163.MCT-18-1046

Figure Lengend Snippet: In vivo PD-L1 surface protein expression in response to different therapeutic modalities. (A)– mRNA expression of PD-L1 from different mouse tumor treatment groups analyzed using RT-PCR. Relative gene expression for RT-PCR data was calculated relative to murine β-actin. (B)– Tumor tissue lysate from different treated groups was prepared and protein level of different proteins was analyzed using western blotting. (C)– The bands corresponding to PD-L1 were quantified using Image J software and was normalized relative to band intensities for the corresponding Histone 3 loading controls. The bar represents the mean ± standard deviation of data from at least 3 independent experiments; *p<0.05, **p<0.01.

Article Snippet: In Vivo Single and Combination Therapies Mouse antibody against PD-L1 (10F.9G2) and relevant isotype IgG control was purchased from Bio X Cell.

Techniques: In Vivo, Expressing, Reverse Transcription Polymerase Chain Reaction, Gene Expression, Western Blot, Software, Standard Deviation

Journal: Molecular cancer therapeutics

Article Title: DHA-SBT-1214 Taxoid Nanoemulsion and Anti-PD-L1 Antibody Combination Therapy Enhances Anti-Tumor Efficacy in a Syngeneic Pancreatic Adenocarcinoma Model

doi: 10.1158/1535-7163.MCT-18-1046

Figure Lengend Snippet: Histopathological evaluation of the Panc02-induced tumor tissues collected from control and different combination treated mice (hematoxylin & eosin staining). Significant reduction in tumor stroma observed with combination of NE-DHA-SBT-1214 and anti-PD-L1 treated groups. The images were taken at 63x magnification.

Article Snippet: In Vivo Single and Combination Therapies Mouse antibody against PD-L1 (10F.9G2) and relevant isotype IgG control was purchased from Bio X Cell.

Techniques: Control, Staining

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Identification of regenerating factor as a regulator of therapeutic genes for Parkinson's disease therapy. A) Conceptual diagram outlining the basis of an epigenetic regulator. B) Comparative gene expression heatmap of substantia nigra (SN) in wild type control versus 6‐OHDA‐induced Parkinson's disease (PD) mouse model. C) Heatmap showing gene expression profiles in the caudate and putamen regions of healthy individuals (HI) and a cohort of human PD patients. BG: Basal Ganglia. D) Immunofluorescence images showing TUJ1‐ and MAP2‐positive cells under each condition. Scale bar = 50 µm. E) Immunochemistry and Sholl analysis of TH‐labeled neurons. Left panel: morphology of individual neurons. Right panel: Sholl analysis showing the number of neurite intersections as a function of distance from the soma. Scale bar = 100 µm. The data are presented as mean ± SEM ( n = 5 – 6 cells per group). F) Representative traces of action potentials evoked by depolarizing current injections under each condition (sham, 6‐OHDA, 6‐OHDA+NDST3). G) Dot plot showing the top 14 GO Biological Process terms from enrichment analyses: 6‐OHDA versus Sham (left side) and 6‐OHDA+NDST3 versus 6‐OHDA (right side). H) Pearson correlation matrix of transcriptomic among samples.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Gene Expression, Control, Immunofluorescence, Labeling

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Therapeutic efficacy of NDST3 and retrograde tracing with CTB in mice. A) Schematic diagram of in vivo experimental design involving CTB injection in the PD mouse model. B) Representative immunofluorescence images of CTB, TH, and NDST3 expression in the SN of Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). C) Quantification of CTB‐, TH‐, and NDST3‐positive cells shown in Figure . Data are presented as mean ± SEM ( n = 6 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. ** p < 0.01, *** p < 0.001, **** p < 0.0001, and ns = not significant. D) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). E) 3D Z‐stack analysis (IMARIS) of TH‐positive neurons obtained via confocal microscopy. F) DAB‐DAT staining in the SN.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Drug discovery, Retrograde Tracing, In Vivo, Injection, Immunofluorescence, Expressing, Confocal Microscopy, Staining

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Efficacy and electrophysiological properties of NDST3 in chemical‐induced PD model. A) Representative traces of spontaneous firing currents recorded from DA neurons of the SNpc in brain slices from each group. B) Cumulative fractions curves showing shortened inter‐event intervals, indicating a higher frequency of spontaneous firing in the 6‐OHDA + NDST3 group compared to the 6‐OHDA group. The inner bar graph showed mean inter‐event intervals in the ipsilateral of SNpc of each group. Data are presented as mean ± SEM ( n = 6 – 8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001. C) Quantification of DA neuronal firing rates in the ipsilateral SNpc of each group. The data are presented as mean ± SEM ( n = 6–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, and ** p < 0.01. D) Representative in vivo recording traces from the SNpc of live animals in each condition. E) Instantaneous firing frequencies during the recorded period. ( n = 4–6 independent animals per group; repeated measures) Two‐way ANOVA with Tukey's multiple comparisons test, * p < 0.05. F) Comparison of action potential waveforms among DA neurons across conditions. G) Representative image of DAB‐TH staining in ST and SN. Scale bar = 1 mm. H) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, MPTP‐induced PD mice, NDST3‐treated PD mice, and NDST3 only‐treated mice. Scale bar = 50 µm and 10 µm (Magnified image). I) Error count during the challenging beam traversal test for each experimental condition. The data are presented as mean ± SEM. ( n = 7 – 8 independent animals per group) Two‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. J) Errors per step during the challenging beam traversal test across conditions. The data are presented as mean ± SEM ( n = 7 – 8 independent animal per group). One‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. K) Fall latency in the wire‐hanging test. The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001 and **** p < 0.0001. L) Time to orient downward (T‐turn) and M) time to descend to the base (T‐total). The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, *** p < 0.001 and **** p < 0.0001.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: In Vivo, Comparison, Staining, Immunofluorescence

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Molecular mechanisms of NDST3 in the PD model. A) One‐way hierarchical clustering heatmap based on Z‐score of normalized expression value for 5629 genes selected with fold change ≥ 2 and raw p ‐value < 0.05. B) Principal component analysis (PCA) analysis of RNA‐seq data to visualize sample‐to‐sample variation. C) Volcano plot showing differentially expressed genes between 6‐OHDA and Sham group; Down‐regulated genes marked in blue. D) Volcano plot showing differentially expressed genes between 6‐OHDA+NDST3 and 6‐OHDA; Up‐regulated genes marked in red. E) Dot plot of top 14 GO cellular component terms from GO enrichment analyses: 6‐OHDA+NDST3 versus 6‐OHDA. Heatmap showing gene expression patterns in F) pre‐synaptic neurons, G) post‐synaptic neurons, and H) glia compartments. I) UMAP visualizing cluster identity. J) UMAP representation comparing cellular composition in 6‐OHDA and 6‐OHDA+NDST3. K) Branched trajectory analysis illustrating cell state transitions in a 2D state‐space, where each dot represents a single cell, color‐coded by group identity.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Expressing, RNA Sequencing, Gene Expression, Single Cell

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Comprehensive analysis of spatial transcriptomics and epigenetic modulation following NDST3 treatment in a PD model. A) Heatmap showing gene expression patterns in each cluster. ** p < 0.01, and **** p < 0.0001. B) Gene concept network plot displaying genes enriched in catabolic, metabolic, and wound healing GO categories. The top 30 most differentially expressed genes comparing 6‐OHDA versus Sham and 6‐OHDA+NDST3 versus 6‐OHDA. Node color intensity represents the log2 fold‐change of gene expression. C) Cell‐cell communication network plot illustrating interactions among three distinct cell clusters in 6‐OHDA‐induced PD model (left panel) and NDST3‐treated PD model (right panel), based on ligand–receptor pair probabilities using the CellChat database. Line thickness indicates proportionality to the number of interactions. D) Spatial localization of dopamine‐related markers. E) Spatial mapping of dopaminergic lineage markers identified via scRNA‐Seq. F) Heatmap visualization of CUT&RUN and ATAC‐Seq signal intensity ±2 kb around the TSS. G) Immunofluorescence images showing H3K27ac and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm. H) Venn diagram illustrating overlapping genes among DEGs from RNA‐Seq, scRNA‐Seq Cluster 9, CUT&RUN peak, and ATAC‐Seq peak. Average signal plot of I) CUT&RUN and J) ATAC‐seq signals at over‐enriched TSS regions of the Ncoa7 gene. K) Structure of NDST3‐NCOA7‐H3K27ac complex. Blue – NDST3, Green – NCOA7, and Red – H3K27ac. The yellow boundary represents the interaction region.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Spatial Transcriptomics, Gene Expression, Immunofluorescence, RNA Sequencing

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: cAMP increases Na+/K+-ATPase activity, protein abundance at the plasma membrane and the distance traveled by the Na+/K+-ATPase-containing vesicles in A549-GFPα1 cells. (A) A549-GFPα1 cells were incubated in the absence (CT) or presence of 50 μM forskolin (FSK) for 10 minutes and the Na+/K+-ATPase activity was measured as 86Rb+ uptake. Graph represents mean ± s.e.m. of three experiments. (B) A549-GFPα1 cells were incubated as in A, and the Na+/K+-ATPase abundance at the basolateral plasma membrane was determined by western blot of the BLM fraction using a specific antibody against GFP. E-cadherin was used as a loading control. Graph represents mean ± s.e.m. of three experiments. A representative western blot is shown. (C) The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Vesicles were randomly selected from those that showed plus-end-directed displacement. Left panel shows a representative image of A549-GFPα1 cells. Arrowhead indicates the vesicle whose trajectory is shown in the right panel before (CT) and after FSK treatment (FSK). (D) Average contour length traveled by the vesicles as a function of time. The black line represents control vesicles; at 60 seconds, upon addition of FSK (red line), the vesicles move at a faster rate. The average contour length is determined by averaging over many trajectories as described in the Materials and Methods. **P<0.01; ***P<0.001. Scale bars: 10 μm and 2 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Activity Assay, Incubation, Western Blot, Labeling, Single-particle Tracking, Software

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The three isoforms of myosin-V are expressed in A549 cells. (A) RT-PCR using mRNA obtained from A549 and HeLa cells. Primers used for the amplification are described in supplementary material Table S6. (B) Cell lysates from A549 and HeLa cells were obtained and analyzed by western blot with specific antibodies against the three myosin-V isoforms. A representative western blot is shown. (C) The particulate fraction (100,000 g pellet) of A549-GFPα1 cells was loaded onto a flotation sucrose gradient and eight fractions were recovered. The distribution of the proteins of interest was analyzed by western blotting with specific antibodies. A representative western blot is shown. Rab5 and Rab7 are used as markers of early and late endosomes, respectively. (D) Gradients obtained in C were scanned and the marker content was digitally quantified as indicated. Results are expressed as percentage of the total amount of protein.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Western Blot, Marker

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Myosin-Va and myosin-Vc colocalize with Na+/K+-ATPase. (A) A549-GFPα1 cells were incubated in the absence or presence of 50 μM FSK for 10 minutes, basolateral membranes (BLM) and intracellular compartments (IC) were isolated and the Na+/K+-ATPase abundance was determined by western blot using a specific antibody against GFP. E-cadherin and actin were used as loading controls for the BLM and IC fractions, respectively. Graph represents mean ± s.e.m. of three experiments. A representative western blot is shown. (B) The IC fraction of A549-GFPα1 cells was loaded onto a flotation sucrose gradient and eight fractions were recovered. The distribution of the proteins of interest was analyzed by western blotting with specific antibodies. A representative western blot is shown. C+, positive control.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Incubation, Isolation, Western Blot, Positive Control

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The average speed of Na+/K+-ATPase-containing vesicles moving towards the cell periphery is increased in cells expressing a myosin-Va stalk-tail. (A) Live imaging of A549-GFPα1 cells (green) transiently transfected with a dominant-negative myosin-Va that has a m-cherry-tag (red) (m-cherry-DN-Va). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of one vesicle before (CT) and after forskolin treatment (FSK). (B) Average contour length traveled by the vesicles in A as a function of time. The black line represents the control vesicles; FSK was added at time 60 seconds and is represented as a red line. (C) Live imaging of A549-GFPα1 cells (green) transiently transfected with a dominant-negative myosin-Vc that has a m-cherry-tag (red) (m-cherry-DN-Vc). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of one vesicle before (CT) and after forskolin treatment (FSK). (D) Average contour length traveled by the vesicles in C as a function of time. The black line represents control vesicles; FSK was added at 60 seconds and is represented as the red line. Scale bars: 10 μm and 2 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Expressing, Imaging, Transfection, Dominant Negative Mutation, Labeling

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: The average speed of Na+/K+-ATPase-containing vesicles moving towards the cell periphery is increased in cells expressing a shRNA against myosin-Va. (A) Live imaging of A549-GFPα1 cells (green) transiently transfected with a shRNA against myosin-Va that has a m-cherry-tag (red) (m-cherry-sh-Va). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of two vesicles (arrowheads) under control (CT) conditions. (B) Live imaging of A549-GFPα1 cells (green) transiently transfected with a shRNA against myosin-Vc that has a m-cherry-tag (red) (m-cherry-shRNA-Vc). The movement of the GFP-labeled particles was recorded. Upper panels show a representative image of the transfected A549-GFPα1 cells. Lower panels show the tracking of the movement of two vesicles (arrowheads) under control (CT) conditions (C). Graph represents the average contour length traveled by the vesicles as a function of time, calculated as described in methods. The black line represents the m-cherry-sh-Va vesicles and the red line, the m-cherry-sh-Vc vesicles. (D) A549-GFPα1 cells were transfected with a shRNA against myosin-Va or myosin-Vc, cell lysates were isolated and the myosin-Va (left panel) or myosin-Vc (right panel) abundance was determined by western blot using specific antibodies. E-cadherin and tubulin were used as loading controls. Scale bars: 10 μm and 4 μm (magnified images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Expressing, shRNA, Imaging, Transfection, Labeling, Isolation, Western Blot

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Dominant-negative myosin-Va mimics cAMP-mediated Na+/K+-ATPase increased activity and recruitment to the plasma membrane in A549-GFPα1 cells. (A) Stable clones expressing myosin-Va tail (DN-Va) and myosin-Vc tail (DN-Vc) were generated as described. Expression of the constructs in the permanent clones was analyzed by western blotting using and antibody against the V5 tag. A representative western blot is shown. (B) A549-GFPα1 cells (CT) and A549-GFPα1 cells permanently transfected with DN-Va and DN-Vc were incubated in the absence or presence of 50 μM FSK for 10 minutes and the Na+/K+-ATPase activity was measured as 86Rb+ uptake. Graph represents mean ± s.e.m. of three different experiments. (C) Control (CT), DN-Va and DN-Vc cells were incubated in the absence or presence of 50 μM FSK for 10 minutes and western blots of the basolateral membrane fraction were performed using a specific antibody against GFP. E-cadherin was used as loading control. A representative western blot is shown. *P<0.05; **P<0.01; n.s., not significant; u.s., unstimulated.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Dominant Negative Mutation, Activity Assay, Clone Assay, Expressing, Generated, Construct, Western Blot, Transfection, Incubation

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Myosin-Va and the Na+/K+-ATPase-containing vesicles colocalize. A549-GFPα1 cells were fixed, permeabilized and blocked. Myosin-Va was visualized by using an anti-myosin-Va antibody and a secondary antibody labeled with Alexa Fluor 568. GFP was directly visualized. Cellular distribution of Na+/K+-ATPase-GFPα1 and myosin-Va was analyzed using a Zeiss LSM 510 laser-scanning confocal microscope and colocalization (blue) was determined using the LSM 510 Meta software.

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Labeling, Microscopy, Software

Journal: Journal of Cell Science

Article Title: Myosin-Va restrains the trafficking of Na + /K + -ATPase-containing vesicles in alveolar epithelial cells

doi: 10.1242/jcs.046953

Figure Lengend Snippet: Microtubules and actin filaments are involved in Na+/K+-ATPase traffic. (A) Live imaging of A549 cells incubated with 10 μM nocodazole for 3 hours. The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Upper panels show a representative immunofluorescence of the microtubule cytoskeleton in control (left) and nocodazole (right) conditions. Lower panel shows the tracking of the movement of one vesicle in control (left) and nocodazole (right) conditions. (B) Live imaging of A549 cells incubated with 5 μM cytochalasin D (Cyto D) for 1 hour. The movement of the GFP-labeled particles was recorded as Metamorph stacks and vesicle trajectories were obtained by single-particle tracking using Metamorph software. Upper panels show a representative immunofluorescence of the actin cytoskeleton under control (left) and cytochalasin D (right) conditions. Lower panel shows the tracking of the movement of one vesicle in control (left) and cytochalasin D (right) conditions. (C) Average contour length traveled by the vesicles as a function of time. The blue line represents the control vesicles; the black line, cells treated with cytochalasin D and the red line, cells treated with nocodazole. Scale bars: 10 μm and 2 μm (inset images).

Article Snippet: Cell culture Human A549 (ATCC CCL 185) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 20 mM HEPES.

Techniques: Imaging, Incubation, Labeling, Single-particle Tracking, Software, Immunofluorescence

Journal: iScience

Article Title: YAP condensates are highly organized hubs

doi: 10.1016/j.isci.2024.109927

Figure Lengend Snippet:

Article Snippet: U-2 OS (ATCC, HTB-96) and YAP–HaloTag CRISPR knock-in U-2 OS cells were cultured at 37°C and 5% CO 2 in DMEM supplemented with 10% fetal bovine serum (FBS; Gibco, 26140079), 100 U/ml (1%) penicillin/streptomycin (Gibco, 15140122) and 2 mM (1%) GlutaMAX-l (Gibco, 35050061).

Techniques: Virus, Recombinant, Modification, Protease Inhibitor, Transfection, Reverse Transcription, SYBR Green Assay, Hybridization, Single Particle, CRISPR, Knock-In, Negative Control, Plasmid Preparation, Software

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a Downregulation of SELENOW during osteoclastogenesis. Osteoclast precursors were cultured with RANKL and M-CSF, and SELENOW gene expression was analysed by RT-PCR, northern blotting (NB), and immunoblotting (IB). b , c RANKL/RANK/TRAF6 axis-dependent downregulation of SELENOW . Osteoclast precursors were pretreated with interferon-γ (IFN-γ; 150 U/ml), which degrades TRAF6, 30 min prior to RANKL stimulation. Osteoclast precursors treated with IFN-γ ( b ) and TRAF6-deficient osteoclast precursors ( c ) failed to induce RANKL-mediated SELENOW downregulation. d Up- and downregulation of SELENOW via ERK and p38 activation, respectively. Osteoclast precursors were pretreated with inhibitors of ERK (PD98059), JNK (SP600125), p38 (SB203580), NF-κB (SN50), and NFATc1 (cyclosporin A, CsA) for 30 min in the presence of M-CSF and then stimulated with RANKL for 2 days. The expression levels of SELENOW were analysed using RT-PCR. e , f Decreased and increased osteoclast formation following SELENOW knockdown ( e ) and overexpression ( f ), respectively. Osteoclast precursors infected with shRNA-mediated SELENOW gene-silencing lentivirus and SELENOW -overexpressing retrovirus were differentiated into osteoclasts and TRAP-positive multi-nucleated cells (TRAP + MNCs) with more than 3 nuclei were assessed ( n = 3). Scale bars, 100 μm. Images are representative of three independent experiments. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( f ). One-way ANOVA was performed followed by Turkey’s test ( e ). Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Cell Culture, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Northern Blot, Western Blot, Activation Assay, Expressing, Knockdown, Over Expression, Infection, shRNA, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched SELENOW −/− mice at 10 weeks. BV/TV, trabecular bone volume per tissue volume; Tb.N, trabecular bone number; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; BMD, bone mineral density. Scale bar, 0.5 mm. b , c Reduced osteoclast formation on the trabecular bone surface of SELENOW −/− mice. H&E- and TRAP-stained sections of tibiae were used to detect osteoblasts ( b ) and osteoclasts ( c ), respectively. NOb/BS, number of osteoblasts per bone surface; NOc/BS, BV/TV, trabecular bone volume per tissue volume; number of osteoclasts per bone surface. In addition, osteoclast size and eroded bone surface were analysed from the TRAP-stained sections. Scale bar, 100 μm. d Increased bone mass phenotype in μCT analysis of proximal tibiae from WT male littermates ( SELENOW tm1c/tm1c ; SeW fl/fl ) and age/sex-matched osteoclast-specific SELENOW knockout mice ( SELENOW tm/c/tm1c :LysM-Cre; SeW fl/fl ;LysM-Cre) at 10 weeks. Scale bar, 0.5 mm. e Analysis of NOb/BS, number of osteoblasts per bone surface, and BV/TV in H&E-stained sections. Scale bar, 100 μm. f Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections. Scale bar, 100 μm. g Histomorphometric analysis of the tibia. BFR, bone formation rate. Scale bar, 10 μm. Data represent mean ± SD ( n = 7 mice per group in a – c ; n = 8 mice per group in d – g ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Staining, Knock-Out, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched transgenic (TG) mice at 10 weeks. Scale bar, 0.5 mm. b μCT images of calvaria and analysis of bone parameters [trabecular bone volume per tissue volume (BV/TV) and BMD]. scale bar, 3 mm. c , d Increased osteoclast formation on the trabecular bone surface of TG mice. Analysis of NOb/BS, number of osteoblasts per bone surface, from H&E-stained sections ( c ). Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections ( d ). Scale bar, 100 μm. e – g Whole calvaria ( e ) and cross-sections ( f ) were stained with TRAP. The number of TRAP + osteoclasts and the calvarial marrow cavity area ( g ), which reflects the degree of osteoporosis, were measured in whole sections. Scale bar, 1 mm. h The level of urinary DPD, a marker of osteoporosis, was measured by enzyme immunoassay. Data represent mean ± SD ( n = 12 mice per group in a , c , d and f , and n = 7 mice per group in b and e – h ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Transgenic Assay, Staining, Marker, Enzyme-linked Immunosorbent Assay, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a Osteoclastogenic transcription factors and SELENOW co-translocate into the nucleus. Osteoclast precursors infected with SELENOW -harbouring retrovirus were cultured with M-CSF and RANKL for 2 days. After cells were exposing to RANKL-free condition for 3 h and treated without or with an inhibitor of NFATc1 (cyclosporin A, CsA), cells were stimulated with RANKL for 20 min. Cytosolic and nuclear proteins were fractionated and NF-κB, NFATc1, and SELENOW levels were determined by immunoblotting. b Luciferase reporter assay. RAW264.7 cells were transfected with AP-1-, NF-κB-, and NFATc1-luciferase reporter or pcDNA3.1-His-tagged SELENOW (SeCys-13) vector. Cells were stimulated with RANKL for 24 h and luciferase activity was measured ( n = 3). c , d SELENOW interacts with NF-κB and NFATc1. Cytosolic extracts from HEK 293 T cells expressing a His-tagged SELENOW (SeCys-13) were pulled down with an anti-His-Tag antibody ( c ). Also, cytosolic extracts from HEK 293T cells with a His-tagged wild-type SELENOW (SeCys-13) and His-tagged SELENOW mutants in which SeCys-13 was replaced by cysteine (SeCys13C) or serine (SeCys13S) were immunoprecipitated (IP) with anti-His-Tag antibody and then immunoblotted (IB) with the indicated antibodies ( d ). e ChIP assay. Osteoclast precursors were cultured with M-CSF alone (d0) or with M-CSF and RANKL for 3 days (d3; left panels). Also, osteoclast precursors from wild-type (WT) and SELENOW -overexpressing transgenic (TG) mice were cultured with M-CSF and RANKL for 3 days (right panels). Following immunoprecipitation (IP) of chromatin with anti-SELENOW antibody, ChIP assay was performed to detect the promoter for NF-κB- or NFATc1-binding sites. f , g 14-3-3γ mediates nuclear translocation of NFATc1, NF-κB, and SELENOW, and osteoclast differentiation. After osteoclast precursors from WT and TG mice were cultured with M-CSF and RANKL for 2 days to induce pre-osteoclasts, the cells were exposed to M-CSF- and RANKL-free condition for 3 h and were stimulated with RANKL for indicated times ( f ; left panel). In addition, this was performed in TG mice-derived pre-osteoclasts transduced with control lentivirus (pLKO) or 14-3-3γ-targeted shRNA-harbouring lentivirus ( f ; right panel). Nuclear proteins were fractionated and subjected to immunoblotting. Osteoclast precursors from TG mice were infected with shRNA-mediated 14-3-3γ gene-silencing lentivirus and differentiated into osteoclasts ( n = 3). TRAP + MNCs with more than 3 or 10 nuclei were assessed ( g ). Scale bar, 100 μm. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( g ). One-way ANOVA was performed followed by Turkey’s test ( b ). Images are representative of three independent experiments. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Infection, Cell Culture, Western Blot, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Activity Assay, Expressing, Immunoprecipitation, Transgenic Assay, Binding Assay, Translocation Assay, Derivative Assay, Transduction, Control, shRNA, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a , b Induction of pre-osteoclast fusion and osteoclastic bone resorption by SELENOW. Fusion assay in pre-osteoclasts from wild-type and SELENOW -overexpressing transgenic mice ( a ) or SELENOW −/− mice ( b ). Osteoclast precursors were treated with M-CSF and RANKL for 2 days to form pre-osteoclasts following fusion assay. Osteoclast fusion rate was determined by counting TRAP + MNCs with a diameter ≥100 μm ( n = 3). c , d Pit formation. Osteoclast precursors prepared from wild-type and SELENOW -overexpressing transgenic mice ( c ) or SELENOW −/− mice ( d ) were differentiated into osteoclasts for 4 days. After mature osteoclasts were detached from the culture dish and seeded on dentine slice, cells were further cultured with M-CSF and RANKL for 2 days to allow bone resorption. Pit formation by osteoclasts is expressed as a percentage of the resorbed area on the bone slice surface ( n = 3). e Anti-apoptotic effect of SELENOW. Mature osteoclasts were transduced with SELENOW -overexpressing retrovirus and cell survival was assessed 2 days later by staining with TRAP (upper panels) or FITC-labelled phalloidin (lower panels) to detect TRAP + osteoclasts with a full actin ring ( n = 3). f Caspase activity was assessed at indicated times after mature osteoclasts were cultured as in ( e , n = 3). g Increase in the cellular redox status by SELENOW. Osteoclasts were transduced with SELENOW -overexpressing retrovirus and total thiol content was assessed at indicated times ( n = 3). h Increase in the cellular redox status by NAC. After treatment with 4 mM NAC for 24 h or no treatment, cytosolic extracts of mature osteoclasts were prepared and assayed for free thiol level ( n = 3). i Increased mature osteoclast survival by NAC ( n = 3). Osteoclasts were treated as described in h and then stained as in e . Scale bars, 100 μm. Data represent mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( a – e , i ). One-way ANOVA was performed followed by Turkey’s test ( f – h ). Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Single Vesicle Fusion Assay, Transgenic Assay, Cell Culture, Transduction, Staining, Activity Assay, Two Tailed Test

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Gene Expression

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: RAD51, miR-214-5P and miR-142-3P are differentially regulated between EA and AA TNBC samples. A Expression of RAD51 in AA ( n = 26) and EA ( n = 26) TNBC patients was analyzed by RT-PCR in two independent experiments in triplicate. B , C Expression of RAD51 in AA ( n = 5) and EA ( n = 5) TNBC patients analyzed by IHC in three independent experiments. D List of the top 30 miRNAs that were differentially regulated in racially different TNBC cell lines [AA (MDAMB468 and HCC1806) and EA (MDAMB231 and MDAMB453)]. E Volcano plot analysis of the miRNA-seq data based on the fold change and p-values in racially different TNBC cell lines [AA (MDAMB468 and HCC1806) and EA (MDAMB231 and MDAMB453)]. F Seed sequence in RAD51 to bind with miR-214-5P and miR-142-3P. G Expression of miR-142-3P in AA ( n = 16) and EA ( n = 16) TNBC patients analyzed by RT-PCR in two independent experiments with triplicates. H Expression of miR-214-5P in AA ( n = 16) and EA ( n = 16) TNBC patients analyzed by RT-PCR in two independent experiments in triplicate. I miR-214 expression in breast cancer patients with different racial backgrounds. (* p < 0.05) and (** p < 0.01)

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Sequencing

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: miR-214-5P regulates the expression of RAD51 in TNBC. A Comparison of RAD51 expression in AA (MDAMB468/HCC1806) and EA (MDAMB231/MDAMB453) TNBC cell lines analyzed by RT-PCR in three independent experiments. B Comparison of miR-142-3P expression in AA (MDAMB468/HCC1806) and EA (MDAMB231/MDAMB453) TNBC cell lines analyzed by RT-PCR in three independent experiments. C Comparison of miR-214-5P expression in AA (MDAMB468/HCC1806) and EA (MDAMB231/MDAMB453) TNBC cell lines analyzed by RT-PCR in three independent experiments. D Western blot analysis of RAD51 in MDAMB468 cells transfected with miR-214-5P at time points indicated. E Western blot analysis of RAD51 in MDAMB468 cells transfected with miR-142-3P at time points indicated. F Western blot analysis of RAD51 in TNBC cells transfected with miR-214-5P. G Histogram representation of cell cycle profile in MDAMB468 cells 48 h after transfected with miR-214-5P in three independent experiments. (*** p < 0.001) and (**** p < 0.0001)

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Expressing, Comparison, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: miR-214-5P binds to RAD51 3’UTR region and regulates RAD51 post-transcriptionally. A Schematic representation of luciferase reporter plasmid. B Histogram representation of luciferase reporter assay performed in MDAMB468 and HCC1806 cells. C RT-PCR analysis of RAD51 expression in miR-214-5P-transfected TNBC cells. Fold-difference with standard deviation is represented as a histogram from three independent experiments. (*** p < 0.001)

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Luciferase, Plasmid Preparation, Reporter Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Transfection, Standard Deviation

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: miR-214-5P mimic downregulates RAD51 and induces HRD. A MDAMB468 cells were transfected with Dr-GFP and selected using 5 µg/ml puromycin. Stably expressing cells were transfected with ISCE-1 and analyzed for GFP + cells using flow cytometry 48 h after transfection. B Histogram representation of GFP + cells from three independent experiments with standard deviation as error bars. C MDAMB468 and D HCC1806 cells were transfected with miR-control or miR-214-5P and analyzed for protein expression using western blot (**** p < 0.0001)

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Transfection, Stable Transfection, Expressing, Flow Cytometry, Standard Deviation, Control, Western Blot

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: miR-214-5P mimic abrogates olaparib-induced RAD51 foci formation. A HCC1806 cells transfected with miR-control or miR-214-5P and treated with or without 25 µM olaparib for 24 h were analyzed for RAD51 foci using immunofluorescence. B More than 75 cells from three independent experiments were analyzed for the percentage of cells that shows > 5 RAD51 foci and represented as a histogram with standard error. C HCC1806 cells transfected with miR-control or miR-214-5P and treated with or without 25 µM olaparib for 24 h was analyzed for pH2AX foci using immunofluorescence. D More than 75 cells from three independent experiments were analyzed for percentage of cells that shows > 7 pH2AX foci and represented as a histogram with standard error. (**** p < 0.0001)

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Transfection, Control, Immunofluorescence

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: miR-214-5P mimic downregulates RAD51 and synergizes with olaparib. A Comet assay representative images of MDAMB468 cells transfected with miR-control or miR-214-5P and treated with or without 25 µM olaparib for 24 h. B MDAMB468 and C HCC1806 analysis of comet tail area in more than 25 cells from three different experiments with their standard deviation as the error bars. D High-density colony assay plates of HCC1806 cells transfected with miR-control or miR-214-5P and treated with different concentrations of olaparib. E Low-density colony assay plates of MDAMB468 cells transfected with miR-control or miR-214-5P and treated with varying concentrations of olaparib. F Survival fraction of MDAMB468 cells transfected with miR-control or miR-214-5P and treated with varying concentrations of olaparib in three independent experiments. G Survival fraction of HCC1806 cells transfected with miR-control or miR-214-5P and treated with varying concentrations of olaparib in three independent experiments

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Single Cell Gel Electrophoresis, Transfection, Control, Standard Deviation, Colony Assay

Journal: Breast Cancer Research : BCR

Article Title: Racial differences in RAD51 expression are regulated by miRNA-214-5P and its inhibition synergizes with olaparib in triple-negative breast cancer

doi: 10.1186/s13058-023-01615-6

Figure Lengend Snippet: Log-fold difference in the expression of miRNAs in AA TNBC (MDAMB468 and HCC1806) cells compared to EA TNBC (MDAMB231 and MDAMB453) cells

Article Snippet: The human TNBC cell lines MDAMB231, MDAMB453, HCC1806, and MDAMB468 were purchased from ATCC, Manassas, VA.

Techniques: Expressing

Journal: Oncogene

Article Title: Epigenomic mapping identifies an enhancer repertoire that regulates cell identity in bladder cancer through distinct transcription factor networks

doi: 10.1038/s41388-023-02662-1

Figure Lengend Snippet: A Cell viability in RT112 and SCaBER under siRNA treatment against FOXA1. B Venn diagram comparing differentially expressed genes in RT112 and SCaBER FOXA1 KD. C GSEA plot of Msig Hallmark GSEA Analysis of genes differentially regulated in RT112 and SCaBER cell lines upon FOXA1 siRNA (2 independent siRNA, 2 replicates). D Heatmap of genes in Hallmark interferon gamma response genes that are differentially regulated in FOXA1 KD vs Ct (min Fold Change = 1,5). E Heatmap of Top Luminal TFs expression in RT112 and SCaBER cell lines upon FOXA1 KD. F PCA projection of TCGA Tumours and CRispR mutant clones on the Basal/Luminal signatures. G GSVA analysis of FOXA1 CRispR mutant clones on Urothelial differentiation signature from Eriksson et al. H GSVA analysis of FOXA1 CRispR mutant clones on Basal TFs identified in Fig. I Overrepresentation analysis of DEG in FOXA1 mutant vs Controls. J Volcano plot of Deseq2 RNA-seq analysis comparing pooled CRispR mutant FOXA1 clones in SD48 and RT112 versus controls. K Transient overexpression of HA-FOXA1 in mutant FOXA1 CRispR clones, wildtype RT112 and SCaBER. qPCR expression of ZBED2 after transfection of HA-FOXA1 relative to control plasmid, 4 days post transfection including 24 h of Puromycin selection ( n = 3 for CrispR clones, n = 2 for WT RT112 and SCaBER). Significance was calculated using 2way ANOVA test ( p -value < 0.05 = *).

Article Snippet: The human bladder cancer-derived cell lines RT112, 5637, KK47, and SCaBER were obtained from DSMZ (Heidelberg, Germany).

Techniques: Expressing, CRISPR, Mutagenesis, Clone Assay, RNA Sequencing Assay, Over Expression, Transfection, Plasmid Preparation, Selection

Journal: Oncogene

Article Title: Epigenomic mapping identifies an enhancer repertoire that regulates cell identity in bladder cancer through distinct transcription factor networks

doi: 10.1038/s41388-023-02662-1

Figure Lengend Snippet: A TCGA expression of ZBED2 by Subtypes. B TCGA expression Heatmap of ZBED2 and FOXA1 and TCGA correlation between ZBED2 and FOXA1. C Expression of FOXA1 and ZBED2 in single-cell transcriptomics from bladder cancer cell lines in the Cancer Cell Line Encyclopedia (CCLE), highlighting the nearly mutually exclusive expression of these genes. D Genome browser view of ZBED2 and FOXA1 loci in SD48 and 5637 cell lines. E GSEA analysis (Hallmark) of ZBED2 correlated genes in basal cells population of GSM4307111 scRNA-seq Tumour. F GSEA analysis (Hallmark) of gene expression upon siZBED2 KD in RT112 (siZBED2-1 and siZBED2-2). G 3’seq STAT2 and CD274 (PD-L1) expression in RT112 and SCaBER after siZBED2 and siFOXA1.

Article Snippet: The human bladder cancer-derived cell lines RT112, 5637, KK47, and SCaBER were obtained from DSMZ (Heidelberg, Germany).

Techniques: Expressing, Single-cell Transcriptomics